Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c5308_9450093

[Submit comment/correction]

Sequence
wsnp_Ku_c5308_9450093
Contig
5BS_933044
Probe
wsnp_Ku_c5308_9450093
DNA Homology
5BS_933044Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
05BS_933044Best IWGSC match
DNA
cgagtaccactgtggctaaatttcagcatggttcgagagagcttcgtacg
aggaagaaaaatgggtggtgtcagtggctagtcatggcctgatgcattcc
Rttgatgcctgctgagttgtgaaatcaattgaattttgcacctgtatcgt
ctcaactttcgatcagttcgcatcaagagttaatgtatatcaagaatatg
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.