Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c5502_9765942

[ Submit comment/correction ]

Sequence
wsnp_Ku_c5502_9765942
Contig
4BL_7021847
Probe
wsnp_Ku_c5502_9765942
DNA Homology
4BL_7021847Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
04BL_7021847Best IWGSC match
DNA
tatcagtgtaaaatccagcaaatcaagtgcagacaagaaagagaagcata
gggaaaacgaaaaatcgaaaagaaaaggacaagatagtggtagatcggag
Ragaagaagaagcgaacttgaagctgccgcttggaattgagattgtctga
ttctggtgttctgtaatcgccagagaaacctctccagaaggggtaagcgg
g
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.