Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c56140_59771244

[Submit comment/correction]

Sequence
wsnp_Ku_c56140_59771244
Contig
1BL_3798174
Probe
wsnp_Ku_c56140_59771244
DNA Homology
1BL_3798174Best IWGSC match1716e-40URGI_BestIWGSC_N
BLAST, e-value
6e-401BL_3798174Best IWGSC match
DNA
tgagcgtgctgatgagagccaaaagagcattctatttgaaaactatggaa
agaaagatccagcatgcgtggcaaaagtgaaggatctctacaaagaactt
Raccttgaggcggtatttcatgagtacgagagcgagagctacaagaagct
gattgctgrtatcgaagcccagccgagcgacgctgttcagaaggttctga
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.