Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c665_1371448

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ku_c665_1371448
Contig
7BS_3164863
Probe
wsnp_Ku_c665_1371448
DNA Homology
7BS_3164863Best IWGSC match3640URGI_BestIWGSC_N
BLAST, e-value
07BS_3164863Best IWGSC match
DNA
tggcggctggttagcatctgcagttttcctcgttgatgctgagctgaatt
catcgtctgatccttcggagtccaccccaccaatgctgtcactgttgttc
Rgctcaggcttcggctgggatgtcggcgctgtgtctttctgaagcaggca
gcaaagtgagtccacccgtgccatcagtcgctcatcrgaggccggcgcct
g
BLAST
BLAST Search