Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c67_136981

[Submit comment/correction]

Sequence
wsnp_Ku_c67_136981
Contig
6AS_4366795
Probe
wsnp_Ku_c67_136981
DNA Homology
6AS_4366795Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
06AS_4366795Best IWGSC match
DNA
aagatctcatcattgctggtctgataatagcaaagaaacaagtcggactg
cctagttcttgcaaccgtggacaaatactatactaaccctccgacaagat
Mtcatcgtcaccatgttgatcagcctcaatcaaggcctttgcttcggcca
gcctgacaccctccgacaagatctcatcgtcaccatgttgatcagcctca
a

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.