Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c754_1557338

[Submit comment/correction]

Sequence
wsnp_Ku_c754_1557338
Contig
1AL_3945542
Probe
wsnp_Ku_c754_1557338
DNA Homology
1AL_3945542Best IWGSC match1930URGI_BestIWGSC_N
BLAST, e-value
01AL_3945542Best IWGSC match
DNA
gcatcacttactaattcccaattttgacccaagtcatggacaaggacaac
aagagcctgatcctcgaagtttgaccatccaccaccagaaggcatcttta
Rcgctttcacttttctcccacggtccttattagtgatgatctttataatt
ttattagcaggcgccatattgctcatctgtgatggaacttgagaaggttc
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.