Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_c7822_13408189

[Submit comment/correction]

Sequence
wsnp_Ku_c7822_13408189
Contig
1DS_1904229
Probe
wsnp_Ku_c7822_13408189
DNA Homology
1DS_1904229Best IWGSC match3150URGI_BestIWGSC_N
BLAST, e-value
01DS_1904229Best IWGSC match
DNA
cccttccagcattgccatgctctgtatttgtcgcagcagcctcagctggg
acgacctgtcggttgtcatttgccagtaaatcccaatcccgtctagctcg
Racgggagaagaaattggagattgtacatgagaatatgcttgctggggca
caatgtcaaggctgggttggttagaagccaccaatgcatttccaggagga
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.