Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_rep_c110147_94431847

[Submit comment/correction]

Sequence
wsnp_Ku_rep_c110147_94431847
Contig
2AL_6364590
Probe
wsnp_Ku_rep_c110147_94431847
DNA Homology
2AL_6364590Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
02AL_6364590Best IWGSC match
DNA
gtgtcttcgtcctcagagctgatgctgtgatcagtgttgccctcataaaa
caggtcatccaccatcttctctacggaagtgttgcaccaataaaggtata
Rtattgctgacaaacttggcttttgaggttctgatgcttactcaaatgcc
atgctgaatatagttgcttttatacttgaaaggaaatgcaaaccagacct
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.