Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ku_rep_c68259_67171095

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ku_rep_c68259_67171095
Species
Triticum aestivum
Probe
wsnp_Ku_rep_c68259_67171095
DNA
TGTCTGAAATTGATGTGCCACAAATCCTGGGTGTCAATTGTATAAGGGGT
ATGTTAACACATAAATTTCTATCAGAAGAATACACTCAACTAAGTGATCC
RTCTCCCGAGCAACCTACCATAGATTGTTTTTCATACCGTTACTACCTAT
GTAATATTTGGGCGAACGATGATTCCACGAGAGAAGCTCTTGGGGTGAAG
C
BLAST
BLAST Search