Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_RFL_Contig2100_1362130

[ Submit comment/correction ]

Sequence
wsnp_RFL_Contig2100_1362130
Contig
6BL_4297422
Probe
wsnp_RFL_Contig2100_1362130
DNA Homology
6BL_4297422Best IWGSC match1542e-35URGI_BestIWGSC_N
BLAST, e-value
2e-356BL_4297422Best IWGSC match
DNA
ccaataaacaagatatgaaaggggcgatgacaccaatggaggtgtgcgaa
Rgccttggcctctatgatttgaagaaccgcgtctggcacatccaagtatg
a
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.