Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_RFL_Contig2171_1489615

[Submit comment/correction]

Sequence
wsnp_RFL_Contig2171_1489615
Contig
5BL_10816677
Probe
wsnp_RFL_Contig2171_1489615
DNA Homology
5BL_10816677Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-445BL_10816677Best IWGSC match
DNA
aagaaagcattctcgttgtacgtgatggagttcttctccccgtcagcttt
Mcccacaaatttgtcgtagcccgcctcattgaagtaaggcttctcgttga
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.