Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_RFL_Contig2446_2008649

[Submit comment/correction]

Sequence
wsnp_RFL_Contig2446_2008649
Contig
1DL_2272161
Probe
wsnp_RFL_Contig2446_2008649
DNA Homology
1DL_2272161Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_2272161Best IWGSC match
DNA
ttcttccaagaagcggcctcacagcccaagtaggagccatagtccttcaa
Rgaaattatcactggatagagaccgagagcacaatcgcagcagagacaga
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.