Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_RFL_Contig2760_2505824

[Submit comment/correction]

Sequence
wsnp_RFL_Contig2760_2505824
Contig
1DL_2236787
Probe
wsnp_RFL_Contig2760_2505824
DNA Homology
1DL_2236787Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-441DL_2236787Best IWGSC match
DNA
ctgttttatttgttcgttttcgctgtgttgtaaaccgttggcggctcgag
Matggtcctctgcaagtgtttgtagcaacatccctcttctgtttttgact
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.