Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_RFL_Contig3057_2961708

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_RFL_Contig3057_2961708
Contig
7BL_6653841
Probe
wsnp_RFL_Contig3057_2961708
DNA Homology
7BL_6653841Best IWGSC match1832.94273e-44URGI_BestIWGSC_N
BLAST, e-value
2.94273e-447BL_6653841Best IWGSC match
DNA
tacgaccctgacagcagaaatgtgaattagaaaagcagtgatagatgctc
Ragagtaacatagaaatgaagttcggcaatgctggtagactacaacctct
t
BLAST
BLAST Search