Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c11600_18784716

[Submit comment/correction]

Sequence
wsnp_Ra_c11600_18784716
Contig
6BL_4204637
Probe
wsnp_Ra_c11600_18784716
DNA Homology
6BL_4204637Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
06BL_4204637Best IWGSC match
DNA
tatcatgttgtgccagcacaggactcctattaaccgcgtcatcattagct
ccttcatctatctggctggaaccatgtatatcggcggtaccgccagtccc
Rtgttctttactattctccccatttgctccattgggctctacattttcag
ctgatgaagttgtagctgcttctgtttcatgcatcttgttggttattgtt
t

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.