Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c18153_27161629

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ra_c18153_27161629
Contig
3B_10762672
Probe
wsnp_Ra_c18153_27161629
DNA Homology
3B_10762672Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
03B_10762672Best IWGSC match
DNA
ggatatgggactactagttcaccgtacaaaactattccccacatacaagc
cacgccacgagagccacacctagacaagcacaactgcaaaggacagatca
Rcatgctaaccaaacagggccagctagaggctaaaccacacctagactgg
aatacataataaacactacaaagccaattaagcgcgtgagtgacacactt
g
BLAST
BLAST Search