Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c26191_35761997

[Submit comment/correction]

Sequence
wsnp_Ra_c26191_35761997
Contig
1AS_3269916
Probe
wsnp_Ra_c26191_35761997
DNA Homology
1AS_3269916Best IWGSC match3390URGI_BestIWGSC_N
BLAST, e-value
01AS_3269916Best IWGSC match
DNA
acattgaatatcacgctgtgttctctacagaccttcctgaggaacgcata
caggtgatccacaacaatcctcttgatgatccctgaatccctgcgcgcgc
Rcacaatggtgttgccgaggatgtgcacgacgccggcgtccttgcagctg
ttgaggaactccagttcgtcrccgtatgtttggctggaataccttgttac
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.