Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c3270_6136110

[Submit comment/correction]

Sequence
wsnp_Ra_c3270_6136110
Contig
1AL_3919966
Probe
wsnp_Ra_c3270_6136110
DNA Homology
1AL_3919966Best IWGSC match3680URGI_BestIWGSC_N
BLAST, e-value
01AL_3919966Best IWGSC match
DNA
aatatcggcacattgtagctctcgaccaaaggttgagctccgaccatggt
ggcgcctctttcatgaggaacgtgtactgggcccacatccggcttcatcg
Rtagagtgtcagggagcaccgggcctgcccattggacacccttgtggttt
ggccggaagtagccgagctcacgccggactgcactgacgctcttgccggt
g

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.