Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c47593_53112812

[Submit comment/correction]

Sequence
wsnp_Ra_c47593_53112812
Contig
5AL_1531245
Species
Triticum aestivum
Probe
wsnp_Ra_c47593_53112812
DNA
tgaaactgaatggaagagtggtggtcacaggraagatgcatacgaaaaaa
gctgagaaacaggttttggtgctattgattgttatttggtaagcttgctc
YCATTGTGCTTGTCGTCGGAAGCAGCAACAACAACAGAAGCAGCCGCTTG
CCTGCTGCCCTACCAAAGCTAAATTAAGTTGTGGAAACTATGTGAGTCTG
C

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.