Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c53181_56932563

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_Ra_c53181_56932563
Contig
1BL_3852986
Probe
wsnp_Ra_c53181_56932563
DNA Homology
1BL_3852986Best IWGSC match1507e-34URGI_BestIWGSC_N
BLAST, e-value
7e-341BL_3852986Best IWGSC match
DNA
gcctatgctgacgtcgacaccctcgattagcaacgtcaggctagcaaaat
atggaaagtggtttaacgacagttccgaggacatcagaacctgctgtgac
Raagctcttcagacactgcacgcacaatacggctgggagactctggatgt
gacggtccctgagattgaggaaatgcggctcgcgcactacgtgacgatcg
g
BLAST
BLAST Search