Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_Ra_c9823_16313377

[Submit comment/correction]

Sequence
wsnp_Ra_c9823_16313377
Contig
4BS_4948049
Probe
wsnp_Ra_c9823_16313377
DNA Homology
4BS_4948049Best IWGSC match3090URGI_BestIWGSC_N
BLAST, e-value
04BS_4948049Best IWGSC match
DNA
ttcttgatgcaaaagctcctcatctttcatcaaccattcctccaaccctt
ccttggaaatctaaagcaccagatcagtctactgaaggccttacacgaca
Rggaagtgggatcattggtacattcggtcagtcagaagaactacgctgcg
tcgttgttgtgatacgccatggtgatcggacaccaaagcagaaggtgaaa
c
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.