Query (optional)   in Class  

GrainGenes Sequence Report: wsnp_be494028A_Ta_2_1

[ Printable Version ]  [ Submit comment/correction ]

Sequence
wsnp_be494028A_Ta_2_1
Contig
7AL_4555035
Probe
wsnp_be494028A_Ta_2_1
DNA Homology
7AL_4555035Best IWGSC match2200URGI_BestIWGSC_N
BLAST, e-value
07AL_4555035Best IWGSC match
DNA
ctccttcactggaaaagcacgcggacccatatcctcgcaacttccatcgt
tctccataaaMatctgcagagatccaaacttgaagctctttcccctatgt
aagcttcggactaatgctgtg
BLAST
BLAST Search