Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_S69414

Sequence
Barley1_S69414
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_S69414 beta-glucuronidase [Escherichia coli, Genomic, 1812 nt]
DNA
atgttacgtcctgtagaaaccccaacccgtgaaatcaaaaaactcgacgg
cctgtgggcattcagtctggatcgcgaaaactgtggaattgatcagcgtt
ggtgggaaagcgcgttacaagaaagccgggcaattgctgtgccaggcagt
tttaacgatcagttcgccgatgcagatattcgtaattatgcgggcaacgt
ctggtatcagcgcgaagtctttataccgaaaggttgggcaggccagcgta
tcgtgctgcgtttcgatgcggtcactcattacggcaaagtgtgggtcaat
aatcaggaagtgatggagcatcagggcggctatacgccatttgaagccga
tgtcacgccgtatgttattgccgggaaaagtgtacgtatcaccgtttgtg
tgaacaacgaactgaactggcagactatcccgccgggaatggtgattacc
gacgaaaacggcaagaaaaagcagtcttacttccatgatttctttaacta
tgccggaatccatcgcagcgtaatgctctacaccacgccgaacacctggg
tggacgatatcaccgtggtgacgcatgtcgcgcaagactgtaaccacgcg
tctgttgactggcaggtggtggccaatggtgatgtcagcgttgaactgcg
tgatgcggatcaacaggtggttgcaactggacaaggcactagcgggactt
tgcaagtggtgaatccgcacctctggcaaccgggtgaaggttatctctat
gaactgtgcgtcacagccaaaagccagacagagtgtgatatctacccgct
tcgcgtcggcatccggtcagtggcagtgaagggcgaacagttcctgatta
accacaaaccgttctactttactggctttggtcgtcatgaagatgcggac
ttgcgtggcaaaggattcgataacgtgctgatggtgcacgaccacgcatt
aatggactggattggggccaactcctaccgtacctcgcattacccttacg
ctgaagagatgctcgactgggcagatgaacatggcatcgtggtgattgat
gaaactgctgctgtcggctttaacctctctttaggcattggtttcgaagc
gggcaacaagccgaaagaactgtacagcgaagaggcagtcaacggggaaa
ctcagcaagcgcacttacaggcgattaaagagctgatagcgcgtgacaaa
aaccacccaagcgtggtgatgtggagtattgccaacgaaccggatacccg
tccgcaaggtgcacgggaatatttcgcgccactggcggaagcaacgcgta
aactcgacccgacgcgtccgatcacctgcgtcaatgtaatgttctgcgac
gctcacaccgataccatcagcgatctctttgatgtgctgtgcctgaaccg
ttattacggatggtatgtccaaagcggcgatttggaaacggcagagaagg
tactggaaaaagaacttctggcctggcaggagaaactgcatcagccgatt
atcatcaccgaatacggcgtggatacgttagccgggctgcactcaatgta
caccgacatgtggagtgaagagtatcagtgtgcatggctggatatgtatc
accgcgtctttgatcgcgtcagcgccgtcgtcggtgaacaggtatggaat
ttcgccgattttgcgacctcgcaaggcatattgcgcgttggcggtaacaa
gaaagggatcttcactcgcgaccgcaaaccgaagtcggcggcttttctgc
tgcaaaaacgctggactggcatgaacttcggtgaaaaaccgcagcaggga
ggcaaacaatga
BLAST
BLAST Search