Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_00040

[ Submit comment/correction ]

Sequence
Barley1_00040
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_00040 contig from HarvEST v. 1.03 assembly 25 [Hordeum vulgare]
DNA
gttcgatttcaccgcccgcagcagccgcccaagccgacttcaccaagcag
cagccgccgacgagcagcagaagcaggcgcgatggcccgtaccaagcaga
ccgcccgcaagtccaccggcggcaaggccccccgcaagcagctcgccacc
aaggcggcgaggaagtcggcgccgaccaccggtggcgtgaagaagcctca
ccgctacaggcccgggaccgtggcgctccgcgagatccgcaagtaccaga
agagcaccgagctgctgatccgcaagctcccgttccagcgcctggtgagg
gagatcgcgcaggacttcaagaccgacctcaggttccagtcccacgccgt
gctggccctccaggaggccgccgaggcgtacctcgtcgggctgttcgagg
acaccaacctgtgcgccatccacgccaagcgcgtcaccatcatgcccaag
gacatccagctcgcccgccgcatccgcggggagcgcgcctaagccaccca
gagcgctgcattcgggagcgatgacaccgttcgccagcattagtattagt
gtagttgattggctttccttgtccagatatgcgtcttgtggttcgttgta
gaaaccctggttggttggttcccgtagttacagagacttttctgcttaag
tggttttggtttgcggtgttgcaaaccgatgcttactgtgatgcaaattg
ttggttaatgtagtgttgattgacaattatcgatggatgaacaaaaaaaa
aaaaaaaaaa
BLAST
BLAST Search

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.