Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_00132

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_00132
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_00132 contig from HarvEST v. 1.03 assembly 25 [Hordeum vulgare]
DNA
ggccccgaagaagccaccagcctcctcctccctcgccgccgcccgccgag
gttggtcgccggacgccatggctcccaccaagaagtcgaagaagagcacg
gagaacatcaacaacaagctgcagctggtgatgaagagcggcaagtacac
cctcggctacaagaccgtcctcaagacgctccggagctccaagggcaagt
tgattatccttgcaaacaactgccctccactcaggaagtctgagatcgag
tactatgctatgctcgccaagatcagtgttcatcacttccatggaaacaa
tgtggatcttggaactgcctgcggcaagtactacagggtgtgctgtttga
gcatccttgaccctggtgactcggacatcatcaccaccgttcctcagtga
agacaaccttacctatcctagtcttaagacgatgtagcgtggagagtcat
gctggccgtctcttgttatcgagccagagctgccaatcgcagtttcagac
caaacatggctgtttttgtaaggcattcctatggttttgttttatgagat
gtttattcctatgtggtccttttactgtgtgcgattggatgattagtggt
gttaacatgttttgcatgcgtggaagcgctggtgcaatcttagatgaaag
aatttttgttttgccctgggcagcgattgagcatacttgttcagggttgc
ctggttgtttttgtgaaacgatttcacagaatatggcacactgatatcac
tatggccagagctgtcgattgtgaatttgttactgaggcttgtctctctt
gaacaaagaaagcctcaagtgattaggtttctgattaggttttagatttg
gagttgtcggtggtagggcccatatctagatcctggaccattcttgcatg
gataccaaaaagtctataatcaggagtacagattcaacagtatgcttttt
gtagtgtatactttctgttttgttagtcatatgaatggtgataatttgac
ctgaaatattagaggctagtaaacatggacgggagggggtattatcaaag
tttcaaatgacgcctttatcattgctttagtgattgaagcggcatgattc
tattttaaactttagatatcatacacaagtacactcgagtattacattat
tcgttaatactttatccctctgtacatatattacgatggttttttgacac
tgacagtataaa
BLAST
BLAST Search