Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_Mla_rtPCR_Franka

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_Mla_rtPCR_Franka
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_Mla_rtPCR_Franka rtPCR amplified product from Franka (similar to Mla6 disease resistance protein) [Hordeum vulgare]
DNA
atggatattgtcaccggtgccatttccaacctgattcccaagttggggga
gctactcacggaggagttcaagctgcacaagggtgtcaagaaaaatattg
aggacctcgggaaggagcttgagagcatgaacgctgccctcatcaagatt
ggtgaggtgccgagggagcagctcgacagccaagacaagctctgggccga
tgaggtcagagagctctcctacgtcattgaggatgtcgtcgacaagttcc
tcgtacaggttgatggcattaagtctgatgataacaacaacaaatttaag
gggctcatgaagaggactaccgagttgttgaagaaagtcaagcataagca
tgggatagctcacgcgatcaaggacatccaagagcaactccaaaaggtgg
ctgataggcgtgacaggaacaaggtatttgttcctcatcctacgagaaca
attgctattgacccttgccttcgagctttgtatgctgaagcgacagagct
agttggcatatatggaaagagggatcaaggcctcatgaggttgctttcca
tggagggcgatgatgcctctaataagagactgaagaaggtctccattgtt
ggatttggagggttgggcaagaccactcttgctagagcggtatacgagaa
gattaaaggtgatttcgattgtcgggcatttgttccggtcggtcagaacc
ctgacatgaagaaggttttaagggatatcctcattgatctcggaaatcct
cactcagatcttgcgatgctggatgccaatcagcttattaaaaagcttca
tgaatttctagagaacaaaaggtatcttgtcataattgatgatatatggg
atgaataattgtgggaaggcatcaactttgctttctccaataggaataat
ctaggcagtcggctaatcaccacaacccgcattgtcagtgtctctaattc
atgttgctcatcagatggtgattctgtttatcaaatggaaccgctttctg
ttgatgactccagaatgctcttctacaaaagaatatttcctgatgagaat
gcatgtataaatgaatttgaacaagtatccagagatattctaaagaaatg
tggtggggtaccactagccataattactatagctagtgctttggctggtg
accagaagatgaaaccaaaatgtgagtgggatattctccttcgttccctt
ggctctggactaacagaagataacagtttagaggagatgcggagaatact
ctctttcagttctggaccttatctgcaacttgtcatatgaagcaaagttt
gtgaatctattggatggcactgggaatagcatgtcttcacagagtaattg
tcgccgtttgtcccttcaaaaaagaaatgaagatcatcaagtcaggcctt
tcacagatatcaagagtatgtcacgagtgaggtcaattactatctttcca
tctgctattgaagtcatgccatctctttcaaggtttgacgttttacgtgt
acttgatctgtcacgatgtaatcttggggagaatagcagcctgcagctta
acctcaaggatgttggacatttaactcacctaaggtaccttggtctagaa
ggtaccaacatcagtaagctccctgctgagataggaaaactgcagttttt
ggaggtgttggatcttggaaacaatcgtaatataaaggaattgccgtcca
cagtttgtaatttcagaagattaatctacctaaatttagttggctgtcag
gtggttcctccagttggtttgttgcaaaatctaacagccatagaagtgtt
gaggggtatcttggtctctctgaacattattgcacaagagcttggcaagt
tgaaaagtatgagggagcttgagattcgcttcaatgatggtagtttggat
ttgtatgaaggtttcgtgaagtctctttgcaacttacatcacatagaaag
cctaatcattggttgcaattctagagaaacatcatcttttgaagtgatgg
atctcttgggagaacggtgggtgcctcctgtacatctccgtgaatttgag
tcgtccatgcctagccaactctctgcactgcgagggtggataaagagaga
cccctcccatctctcaaacctctccgacttagtcctgccagtgaaggaag
tgcaacaggatgacgtggaaatcattggggggttgctggcccttcgccgt
ctctggataaagagcaaccaccaaacacaacggctgctagtcatccctgt
agatgggttccactgtattgttgactttcagttggactgtggatctgcca
cgcagatattgtttgagcctggagctttgccgagggcagaatcagttgtg
atcagtctgggcgtgcgggtggcgaaagaggatggtaaccgtggcttcga
cttgggcctgcaagggaacttgctatcccttcggcggcatgtctttgttc
ttatctattgtggtggagcgagggttggggaggcaaaggaagcgaaggct
gcgctgaggcgtgcccaggaagctcatcccgaccatctccggatttatat
tgacatgaggccgtgtatagcagaaggt
BLAST
BLAST Search