Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_Mla_rtPCR_Franka_b

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_Mla_rtPCR_Franka_b
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_Mla_rtPCR_Franka_b rtPCR amplified product from Franka (similar to Mla6-2 Class B alternative splice variant) [Hordeum vulgare]
DNA
atggatattgtcaccggtgccatttccaacctgattcccaagttggggga
gctgctcacggaggagttcaagctgcacaagggtgtcaagaaaaatattg
aggacctcgggaaggagcttgagagcatgaacgctgccctcatcaagatt
ggtgaggtgccgagggagcagctcgacagccaagacaagctctgggccga
tgagggctcatgaagaggacgaccgagttgttgaagaaagtcaagcataa
gcatgggatagctcacgcgatcaaggacatccaagagcaactccaaaagg
tggctgataggcgtgacaggaacaaggtatcttgtcataattgatgatat
atgggatgaaaaattgtgggaaggcatcaactttgctttctccaatagga
ataatctaggcagtcggctaatcaccacaacccgcattgttagtgtctct
aattcatgttgctcatcagatggtgattcagtttatcaaatggaaccgct
ttctgttgatgactccagaatgctcttctacaaaagaatatttcctgatg
agaatggatgtgtaaatgaatttgaacaagtatccagagatattctaaag
aaatgtggtgggtaccactacccataattactatagctagtgctttggct
ggggaccagaagatgaaaccaaaatgtgagtgggatattctccttcagtc
ccttggctctggactaacagaagataacagtttagaggagatgcggagaa
tactctctttca
BLAST
BLAST Search