Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_Mla_rtPCR_Kwan

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_Mla_rtPCR_Kwan
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_Mla_rtPCR_Kwan rtPCR amplified product from Kwan [Hordeum vulgare]
DNA
atggatattgtcaccggtgccatttccaacctgattcccaagttggggga
gctactcacggaggagttcaagctgcacaagggtgtcaagaaaaatattg
aggacctcgggaaggagcttgagagcatgaacgctgccctcatcaagatt
ggtgaggtgccgagggagcagctcgacagccaagacaagctctgggccga
tgaggtcagagagctctcctacgtcattgaggatgtcgtcgacaagttcc
tcgtacaggttgatggcattaagtctgatgataacaacaacaaatttaag
gggctcatgaagaggactaccgagttgttgaagaaagtcaagcataagca
tgggatagctcacgcgatcaaggacatccaagagcaactccaaaaggtgg
ctgataggcgtgacaggaacaaggtatttgttcctcatcctacgggaaca
attgctattgacccttgccttcgagctttgtatgctgaagcgacagagct
agttggcatatatggaaagagggatcaaggcctcatgaggttgctttcca
tggagggggatgatgcctctaataagagactgaagaaggtctccattgtt
ggatttggagggttgggcaagaccactcttgctagagcggtatacgagaa
gattaaaggtgatttcgattgtcgggcatttgttccggtcggtcagaacc
ctgacatgaagaaggttttaagggatatcctcattgatctcggaaatcct
cactcagatcttgcgatgctggatgccaatcagcttattaaaaagcttca
tgaatttctagagaacaaaaggtatcttgtcataattgatgatatatggg
atgaaaaattgtgggaaggcatcaactttgctttctccaataggaataat
ctaggcagtcggctaatcaccacaacccgcattgtcagtgtctctaattc
atgttgctcatcagatggtgaytctgtttatcaaatggaaccgctttctg
ttgatgactccagaatgctcttctacaaaagaatatttcctgatgagaat
gcatgtataaatgaatttgaacaagtatccagagatattctaaagaaatg
tggtggggtaccactagccataattactatwgctagtgctttggctggtg
accagaagatgaaaccaaaatgtgagtgggatattctccttcggtccctt
ggctctggactaacagaagataacagtttagaggagatgcggagaatact
ctctttcagctattctaatctaccttcgaatctgaaaacttgtctactgt
atctatgtgtatatccagaagatagtatgatttctagagataaantgata
tggaagtgggtggccgaaggatttgtccaccatgaaaatcaaggaaatag
cctgtatttgctcggattaaattacttcaaccagctcattaatagaagta
tgatccagccaatatataattatagcggcgaggcatatgcttgccgtgta
catgatatggttctggaccttatctgcaacttgtcaaatgaagcaaagtt
tgtgaatctattggatggcactgggaatagcatgtcttcacagagtaatt
gtcgccgtttgtcccttcagaaaagaaatgaagatcatcaagccaggcct
ttcacagatatcaagagtatgtcacgagtgaggtcaattactatctttcc
atctgctattgaagtcatgccatctctttcaaggtttgacgttttacgtg
tacttgatctgtcacgatg
BLAST
BLAST Search