Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_U09476

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_U09476
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_U09476 XXU09476 Synthetic construct dihydrofolate reductase from Tn7 (dhfr) gene, complete cds [synthetic construct]
DNA
tgttcaccgcggtggcggccgctctagaactagtggatcctgcaagcagg
atagacggcatgcacgatttgtaataacagagtgtcttgtatttttaaag
aaagtctatttaatacaagtgattatattaattaacggtaagcatcagcg
ggtgacaaaacgagcatgcttactaataaaatgttaacctctgaggaaga
attgtgaaactatcactaatggtagctatatcgaagaatggagttatcgg
gaatggccctgatattccatggagtgccaaaggtgaacagctcctgttta
aagctattacctataaccaatggctgttggttggacgcaagacttttgaa
tcaatgggagcattacccaaccgaaagtatgcggtcgtaacacgttcaag
ttttacatctgacaatgagaacgtattgatctttccatcaattaaagatg
ctttaaccaacctaaagaaaataacggatcatgtcattgtttcaggtggt
ggggagatatacaaaagcctgatcgatcaagtagatacactacatatatc
tacaatagacatcgagccggaaggtgatgtttactttcctgaaatcccca
gcaattttaggccagtttttacccaagacttcgcctctaacataaattat
agttaccaaatctggcaaaagggttaacaagtggcagcaacggattcgca
aacctgtcacgccttttgtgccaaaagccgcgccaggtttgcgatccgct
gtgccaggcgttaggcgtcatatgaagatttcggtgatccctgagcaggt
ggcggaaacattggatgctgagaattcgatatcaagcttatcgataccgt
cgacctcgagaaca
BLAST
BLAST Search