Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_U29604

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_U29604
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_U29604 BYU29604 Barley yellow dwarf virus coat protein mRNA, complete cds [Barley yellow dwarf virus]
DNA
atgaattcagtaggccgtagaggacctagacgagcaaatcaaaatggccc
aagaaggcggagccgtagaacaattcggccagtggttgtggtccaaccca
atcgagcaggacccagacgacgaaatggtcgacgctcaggaagaagaggg
ccaaattctatacctggatcaacaggcaggactgaggtattcatattctc
agtcgacaaccttaaagccaactcttccggggcaatcaaattcggcccca
gtttatcgcaatgcccagcgctttcagacggaatacttaagtcctaccac
cgttacaagatcacaagtatccgtgttaagtttcagtcacacgcgtccgc
cgctacgtcaggcgctatctttgttgaactcgacaccgcgtgcaagcaat
cagccttgggtagctacattaattccttcaccatcagcaaaactgcctcc
aagtccttcagagccgaggcgattaatgggaaggaattccaagaatcaac
gatagaccaattctggctactctacaaggcaaatgggaccactactgaca
ccgctggacagttcattataacgataaacgtcagtatgttaactcccaaa
tag
BLAST
BLAST Search