Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_U43284.CDS

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_U43284.CDS
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_U43284.CDS Cloning vector phGFP-S65T, complete sequence, green fluorescent protein (gfp) gene, complete cds [Cloning vector phGFP-S65T]
DNA
atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggt
cgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagg
gcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacc
accggcaagctgcccgtgccctggcccaccctcgtgaccaccttcaccta
cggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgact
tcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttc
ttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgaggg
cgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagg
acggcaacatcctggggcacaagctggagtacaactacaacagccacaac
gtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaa
gatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactacc
agcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccac
tacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcga
tcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggca
tggacgagctgtacaagtaa
BLAST
BLAST Search