Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_U47295.88-1740

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_U47295.88-1740
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_U47295.88-1740 From cloning vector pGL3-Basic, firefly luciferase (luc) gene [Cloning vector pGL3-Basic]
DNA
atggaagacgccaaaaacataaagaaaggcccggcgccattctatccgct
ggaagatggaaccgctggagagcaactgcataaggctatgaagagatacg
ccctggttcctggaacaattgcttttacagatgcacatatcgaggtggac
atcacttacgctgagtacttcgaaatgtccgttcggttggcagaagctat
gaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaa
actctcttcaattctttatgccggtgttgggcgcgttatttatcggagtt
gcagttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacag
tatgggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgc
aaaaaattttgaacgtgcaaaaaaagctcccaatcatccaaaaaattatt
atcatggattctaaaacggattaccagggatttcagtcgatgtacacgtt
cgtcacatctcatctacctcccggttttaatgaatacgattttgtgccag
agtccttcgatagggacaagacaattgcactgatcatgaactcctctgga
tctactggtctgcctaaaggtgtcgctctgcctcatagaactgcctgcgt
gagattctcgcatgccagagatcctatttttggcaatcaaatcattccgg
atactgcgattttaagtgttgttccattccatcacggttttggaatgttt
actacactcggatatttgatatgtggatttcgagtcgtcttaatgtatag
atttgaagaagagctgtttctgaggagccttcaggattacaagattcaaa
gtgcgctgctggtgccaaccctattctccttcttcgccaaaagcactctg
attgacaaatacgatttatctaatttacacgaaattgcttctggtggcgc
tcccctctctaaggaagtcggggaagcggttgccaagaggttccatctgc
caggtatcaggcaaggatatgggctcactgagactacatcagctattctg
attacacccgagggggatgataaaccgggcgcggtcggtaaagttgttcc
attttttgaagcgaaggttgtggatctggataccgggaaaacgctgggcg
ttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtccggt
tatgtaaacaatccggaagcgaccaacgccttgattgacaaggatggatg
gctacattctggagacatagcttactgggacgaagacgaacacttcttca
tcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggct
cccgctgaattggaatccatcttgctccaacaccccaacatcttcgacgc
aggtgtcgcaggtcttcccgacgatgacgccggtgaacttcccgccgccg
ttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtggat
tacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgt
gtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaa
aaatcagagagatcctcataaaggccaagaagggcggaaagatcgccgtg
taa
BLAST
BLAST Search