Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_U55385.4264-4644

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_U55385.4264-4644
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_U55385.4264-4644 From complete sequence of plasmid pRL1063a, bleomycin resistance gene [Plasmid pRL1063a]
DNA
atgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccac
cgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccg
gctggatgatcctccagcgcggggatctcatgctggagttcttcgcccac
cccgggctcgatcccctcgcgagttggttcagctgctgcctgaggctgga
cgacctcgcggagttctaccggcagtgcaaatccgtcggcatccaggaaa
ccagcagcggctatccgcgcatccatgcccccgaactgcaggagtgggga
ggcacgatggccgctttggtcgacccggacgggacgctcctgcgcctgat
acagaacgaattgcttgcaggcatctcatga
BLAST
BLAST Search