Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_V00087

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_V00087
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_V00087 ATNOPA Agrobacterium tumefaciens gene encoding nopaline synthetase. (Resident in plasmid pTiT37.) [Agrobacterium tumefaciens]
DNA
tagccgacccagacgagccaagggatctttttggaatgctgctccgtcgt
caggctttccgacgtttgggtggttgaacagaagtcattatcgtacggaa
tgccaagcactcccgaggggaaccctgtggttggcatgcacatacaaatg
gacgaacggataaaccttttcacgcccttttaaatatccgttattctaat
aaacgctcttttctcttaggtttacccgccaatatatcctgtcaaacact
gatagtttaaactgaaggcgggaaacgacaatctgatcatgagcggagaa
ttaagggagtcacgttatgacccccgccgatgacgcgggacaagccgttt
tacgtttggaactgacagaaccgcaacgattgaaggagccactcagccgc
gggtttctggagtttaatgagctaagcacatacgtcagaaaccattattg
cgcgttcaaaagtcgcctaaggtcactatcagctagcaaatatttcttgt
caaaaatgctccactgacgttccataaattcccctcggtatccaattaga
gtctcatattcactctcaatccaaataatctgcaatggcaattaccttat
ccgcaacttctttacctatttccgccgcagatcaccatccgcttcccttg
accgtaggtgtcctcggttctggtcacgcggggactgcattagcggcttg
gttcgcctcccggcatgttcccacggcgctgtgggcaccagcagatcatc
caggatcgatctcagcaatcaaggccaatgaaggagttatcaccaccgag
ggaatgattaacggtccatttagggtctcagcctgtgatgaccttgccgc
agttattcgctccagccgtgtactgattattgtaacccgtgcggacgttc
acgacagcttcgtcaacgaactcgccaacttcaacggcgaactcgcaaca
aaggatattgtcgtcgtgtgcggccatggcttctccatcaagtacgagag
acagctgcgattcaagcgaatattcgagacggataattcgcccataacgt
ctaagctatcggatcaaaaaaaatgtaacgtcaacatcaaggaaatgaaa
gcgtctttcggactgtcatgtttcccaattcatcgcgatgatgctggcgt
gattgatctacccgaagataccaagaacatctttgcccagctattttccg
ctagaatcatctgcatcccgccgttgcaagtgctattcttttccaactgt
atcactcatgcggttccggcagtcatgaacatcggaagactccgcgaccc
agccaattctcttactaaaagagctgagaagtggcttcttgaactagacg
agcgaaccccacgagccgagaagggctttttcttttatggtgaaggatcc
aacacttacgtttgcaacgtccaagagcaaatagaccacgaacgccggaa
ggttgccgcagcgtgtggattgcgtctcaattctctcttgcaggaatgca
atgatgaatatgatactgactatgaaactttgagggaatactgcctagca
ccgtcacctcataacgtgcatcatgcatgccctgacaacatggaacatcg
ctatttttctgaagaattatgctcgttggaggatgtcgcggcaattgcag
ctattgccaacatcgaactacccctcacgcatgcattcatcaatattatt
catgcggggaaaggcaagattaatccaactggcaaatcatccagcgtgat
tggtaacttcagttccagcgacttgattcgttttggtgctacccacgttt
tcaataaggacgagatggtggagtaaagaaggagtgcgtcgaagcagatc
gttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggt
cttgcgatgattatcatataatttctgttgaattacgttaagcatgtaat
aattaacatgtaatgcatgacgttatttatgagatgggtttttatgatta
gagtcccgcaattatacatttaatacgcgatagaaaacaaaatatagcgc
gcaaactaggataaattatcgcgcgcggtgtcatctatgttactagatcg
atcaaacttcggtactgtgtaatgacgatgagcaatcgagaggctgacta
acaaaaggtatgcccaaaaacaacctctccaaactgtttcgaattggaag
tttctgctcatgccgacaggcataacttagatattcgcgggctattccca
ctaattcgtcctgctggtttgcgccaagataaatcagtgcatctccttac
aagttcctctgtcttgtgaaatgaactgctgactgccccccaagaaagcc
tcctcatctcccagttggcggcggctgatacaccatcgaaaacccacgtc
cgaacacttgatacatgtgcctgagaaataggcctacgtccaagagcaag
tcctttctgtgctcgtcggaaattcctctcctgtcagacggtcgtgcgca
tgtcttgcgttgatgaagctt
BLAST
BLAST Search