Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_X17220

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_X17220
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_X17220 SHBARPA Streptomyces hygroscopicus bar gene for phosphinothricin acetyl transferase [Streptomyces hygroscopicus]
DNA
gaattcgagctcggtacccggggatctaccatgagcccagaacgacgccc
ggccgacatccgccgtgccaccgaggcggacatgccggcggtctgcacca
tcgtcaaccactacatcgagacaagcacggtcaacttccgtaccgagccg
caggaaccgcaggagtggacggacgacctcgtccgtctgcgggagcgcta
tccctggctcgtcgccgaggtggacggcgaggtcgccggcatcgcctacg
cgggcccctggaaggcacgcaacgcctacgactggacggccgagtcgacc
gtgtacgtctccccccgccaccagcggacgggactgggctccacgctcta
cacccacctgctgaagtccctggaggcacagggcttcaagagcgtggtcg
ctgtcatcgggctgcccaacgacccgagcgtgcgcatgcacgaggcgctc
ggatatgccccccgcggcatgctgcgggcggccggcttcaagcacgggaa
ctggcatgacgtgggtttctggcagctggacttcagcctgccggtaccgc
cccgtccggtcctgcccgtcaccgagatctgatgacccgggggatccctg
caggcatgcaagctt
BLAST
BLAST Search