Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_X58791.137-1204

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_X58791.137-1204
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_X58791.137-1204 From V. harveyi luxA and luxB genes for luciferase alpha and beta subunits, luxA gene [Vibrio harveyi]
DNA
atgaaatttggaaacttccttctcacttatcagccacctgagttatctca
gaccgaagtgatgaagcgattggttaatctgggcaaagcgtctgaaggtt
gtggtttcgacacagtttggttactagagcaccacttcactgagtttggg
ttgttagggaatccttatgttgctgccgcacatctattaggtgcgacaga
aaagctcaatgttggcaccgcagctattgtattgccgactgcccatccgg
ttcgacaagcagaagacgtaaacctactggatcaaatgtcaaaaggacga
ttccgttttggtatttgtcgcggtttgtacgacaaagatttccgtgtctt
tggtacagacatggataacagccgagccttaatggactgttggtatgact
tgatgaaagaaggcttcaatgaaggctatatcgcggcggataacgaacat
attaagttcccgaaaatccaactgaatccatcggcttacacacaaggtgg
cgctcctgtttatgtcgtcgcggagtcagcgtcaacgacagaatgggctg
cagagcgtggcctaccaatgattctaagctggatcatcaacactcacgag
aagaaagcgcacgttgatctttacaatgaagttgcgactgaacatggcta
cgatgtgactaagattgaccactgtttgtcttacatcacctccgtcgatc
atgactcaaataaagccaaagatatttgccgcaacttcttgggtcattgg
tacgactcatacgtgaatgccacaaagatttttgacgactctgaccaaac
aaaaggctacgacttcaataaaggtcaatggcgtgattttgtcttgaaag
gccacaaagacaccaatcgccgaattgattacagctacgaaatcaaccca
gtagggacgcctgaagagtgtatcgcgattatccagcaagatatcgatgc
gacgggtattaacaatatttgttgtggttttgaagcaaacggttctgaag
aagaaattatcgcatctatgaagctattccagtctgatgtgatgccatat
ctcaaagaaaaacagtaa
BLAST
BLAST Search