Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_X62655

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_X62655
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_X62655 ZMDSEWXM5 Zea mays DNA of Ds element in Wx-m5 allele [Zea may]
DNA
tagggatgaaaacggtcgggaacggtcggtaaaatacctctaccgttttc
attttcatatttaacttgcgggacggaaacgaaaacgggatataccggta
acgaaaacgaacgggataaatacggtaatcgaaaaccgatacgatccggt
cgggttaaagtcgaaatcggacgggaaccggtatttttgttcggtaaaat
cacacatgaaaacatatattcaaaacttaaaaacaaatataaaaaattgt
aaacacaagtcttaattaaacatagataaaatccatataaatctggagca
cacatagtttaatgtagcacataagtgataagtcttgggctcttggctaa
cataagaagccatataagtctactagcacacatgacacaatataaagttt
aaaacacatattcataatcacttgctcacatctggatcacttagcatgca
taaactattacaaccaaggctcatccgtcaacaaacataagacacattgc
tcatggagaggagccacttgctacatcttcattattcttagaaaattcta
ttgcgtcttcatcctgttaatacacaaaaataagtcagttttggataaat
aaatacatatagaagaacatgaattgatatgcagggagtataaataaata
catataggagaacatgaatctgtgaactaacacggctgggagctaggcag
ctagcagctagcgcctaacagctgggagcctaacagctagcagctagcag
ccaatcaaaacaaggcgacaaggcgcatgcagtgagatcaaaaatctgtt
aatgccagccatgcagggagtataacacggctgggcagcaaggcgcatgc
atcaaaacaaggcgacagcaaacagcccatgcatcaaaacagtagtgaat
aatagcaaattaatagcccatgcacgaagtaaataataatctttaaatac
ctcatccatatgattctcatgatttgttgcagcagcaataacagcatcaa
cttggccaatcttatggctgagctgagggaggattatttccaaccggagg
cgtcatctgaggaatggagtcgtagccggctagcaggtgttcagcaatca
gcttggtgctgtactgctgtgacttgtgagcacctggacggctggacagc
aatcagcaggtgttgcagagcccctggacagcacacaaatgacacaacag
cttggtgcaatggtgctgacgtgctgtactgctaagtgctgtgagcctgt
gagcagccgtggagacagggagaccgcggatggccggatgggcgagcgcc
gagcagtggaggtctggaggaccgctgaccgcagatggcgatggcggatg
ggcggacccgggatgggcgagcagtggagtggaggtctgggcggatgggc
ggaccgcggcgcggatgggcgagtcgcgagcagtggagtggagggcggac
cgtggatggcggcgtctgcgtccggcgtgccgcgtcacggccgtcaccgc
gtgtggtgcctggtgcagcccagcggccggccggctgggagacagggaga
gtcggagagagcaggcgagagcgagacgcgcgccggcgtcggcgtgcggc
tgccggcgtccggactccggcgtgggcgggtggcggcgtgtgaatgtgtg
atgctgttactcgtgtggtgcctcgccgcctgggagagaggcagagcacg
gttcgctaggtatttcttacatgggctgggcctcagtggttatggatggg
agttggagctggccatattgcagtcatcccgaattagaaaatacggtaac
gaaacgggatcattccgattaaaaacgggatcccggtgaaacggtcggga
aactagctctaccgtttccgtttccgtttaccgttttgtatatcccgttt
ccgttccgttttcgttttttacctcgggttcgaaatcgatcgggataaaa
ctaacaaaatcggttatacgataacggtcggtacgggattttcccatcct
actttcatcccta
BLAST
BLAST Search