Query (optional)   in Class  

GrainGenes Sequence Report: Barley1_X65526

[ Printable Version ]  [ Submit comment/correction ]

Sequence
Barley1_X65526
Data at PLEXdb
Probe annotation
Data Source
HarvEST:BarleyMay 2003, via http://www.barleybase.org/download.php
Title
Barley1_X65526 NPXYNAMR N.patriciarum mRNA for xylanase A [Neocallimastix patriciarum]
DNA
ttttattatatcaatctctaatttatttttttaggaaaaaaataaaaaaa
taaatataataaatattagagagtaatatttaaaaacaaagaaatttaaa
aacgtttatttagttattttttttactggttaaaaaaaaaataaaaaaca
aaattaataaagatatttttgaaaaatattgaattagaaaaaaaatgaga
actattaaattctttttcgcagtagctattgcaactgttgctaaggccca
atggggtggaggtggtgcctctgctggtcaaagattaaccgtcggtaatg
gtcaaacccaacataagggtgtagctgatggttacagttatgaaatctgg
ttagataacaccggtggtagtggttctatgactctcggtagtggtgcaac
cttcaaggctgaatggaatgcatctgttaaccgtggtaacttccttgccc
gtcgtggtcttgacttcggttctcaaaagaaggcaaccgattacagctac
attggattggattatactgcaacttacagacaaactggtagcgcaagtgg
taactcccgtctctgtgtatacggttggttccaaaaccgtggagttcaag
gtgttccattggtagaatactacatcattgaagattgggttgactgggtc
tcagatgcacaaggtagaatggtaaccattgatggagctcaatataagat
tttccaaatggatcacactggtccaactatcaatggtggtagtgaaacct
ttaagcaatacttcagtgtccgtcaacaaaagagaacttctggtcatatt
actgtctcagatcactttaaggaatgggccaaacaaggttggggtattgg
taacctttatgaagttgctttgaacgccgaaggttggcaaagtagtggta
tagctgatgtcaccaagttagatgtttacacaacccaaaaaggttctaat
cctgcccctacctccactggtactgttccaagcagttctgctggtggaag
tactgccaatggtaaaaagtttactgtcggtaatggacaaaaccaacata
agggtgtcaacgatggtttcagttatgaaatctggttagataacactggt
ggtaacggttctatgactctcggtagtggtgcaactttcaaggctgaatg
gaatgcagctgttaaccgtggtaacttccttgcccgtcgtggtcttgact
tcggttctcaaaagaaggcaaccgattacgactacattggattagattat
gctgctacttacaaacaaactgccagtgcaagtggtaactcccgtctctg
tgtatacggatggttccaaaaccgtggacttaatggcgttcctttagtag
aatactacatcattgaagattgggttgactgggttccagatgcacaagga
aaaatggtaaccattgatggagctcaatataagattttccaaatggatca
cactggtccaactatcaatggtggtagtgaaacctttaagcaatacttca
gtgtccgtcaacaaaagagaacttctggtcatattactgtctcagatcac
tttaaggaatgggccaaacaaggttggggtattggtaacctttatgaagt
ggctttgaacgccgaaggttggcaaagtagtggtgttgctgatgtcacct
tattagatgtttacacaactccaaagggttctagtccagccacctctgcc
gctcctcgtactactacccgtactactactcgtaccaagtctcttccaac
caattacaataagtgttctgctagaattactgctcaaggttacaagtgtt
gtagcgatccaaattgtgttgtttactacactgatgaggatggtacctgg
ggtgttgaaaacaacgactggtgtggttgtggtgttgaacaatgttcttc
caagatcacttctcaaggttacaagtgttgtagcgatccaaattgcgttg
ttttctacactgatgacgatggtaaatggggtgttgaaaacaacgactgg
tgtggttgtggtttctaagcagtaaaatactaattaataaaaaattaaag
aattatgaaaaatttaaatttaaaaatttaaaagaattatgaaaaattta
aatttaaaaatttaaaaaaaactaatttagtaaaaaattaaagaattatt
gaaaattttaaatgtaaaaatttaaaaaatacaaatttgtaaaaaaaaat
gaaagaattatgaaaaattaaaatgtaaaagtttaaaaaatacaaatttg
taagaaaaataaagaattataaaaaaaataaagaattatgaaaaacccaa
atgtaaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search