Query (optional)   in Class  

GrainGenes Sequence Report: A21630

[ Printable Version ]  [ Submit comment/correction ]

Sequence
A21630
Subsequence
A21630_1.cds1237
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
pre-sequence wheat 33K.
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic DNA';
Gene: pre-sequence wheat 33K
EMBL Feature
feature_gene1237Location: 1..237
DNA
atggcagcgtctctccaagccgcggccacgctgatgccggccaagatcgg
cggccgggcctcctccgcgcgaccgtcgtcgcacgtcgcccgggcgttcg
gcgtcgacgctggcgccaggatcacctgctccctgcagtccgacatcagg
gaggtcgcaagcaagtgcgccgacgccgccaagatggccggcttcgccct
cgccacctctgccctcctcgtctccggcgcgacggcg
BLAST
BLAST Search