Query (optional)   in Class  

GrainGenes Sequence Report: A26500

[ Printable Version ]  [ Submit comment/correction ]

Sequence
A26500
Subsequence
A26500_1.cds1354
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
Data at Gramene
Gramene-Protein P04399
DB Remark
Locus Source: Hordeum vulgare
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
Barley PSI cDNA clone.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Gene: PSI
EMBL Feature
feature_gene1499Location: 1..499
DNA
gcggtgacgacgctgctcctcatggtgaacgaggccacgcggttccagac
ggtgtcggggttcgtggccgggctgctgcaccccaaggcggtggagaaga
agagcgggaagatcggcaatgagatgaaggcccaggtgaacgggtggcag
gacctgtccgcggcgctgctgaagacggacgtgaagcccccgccgggaaa
gtcgccagcgaagttcacgccgatcgagaagatgggcgtgaggactgctg
agcaggctgcggctactttggggatcctgctgttcgttgaggtgccgggt
gggttgacggtggccaaggcgctggagctgtttcatgcgagtggtgggaa
ataggtagttttgcaggtatacctgcatgggtaaatgtaaaagtcgaata
aaaatgtcacagagtgacggactgatataaataaattaataaacatgtca
tcatgagtgacagactgatataaataaataaaaaaaaaaaaaaaaaaaa
BLAST
BLAST Search