Query (optional)   in Class  

GrainGenes Sequence Report: AZ048438

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AZ048438
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
Keyword
GSS
Species
Hordeum vulgare subsp. vulgare
Cultivar
Betzes
Clone Library
Barley PstI genomic clones
Tissue
Leaf
Data Source
genbankRelease 135, Apr 15 2003
Title
PSB19 Barley PstI genomic clones Hordeum vulgare subsp. vulgare genomic clone PSB19, DNA sequence.
Clone
PSB19
Remark
DB_xref: taxon:112509
Locus Comment: Contact: Laurie DA; Cereals Research Department; John Innes Centre; Norwich Research Park, Colney, Norwich NR4 7UH, UK; Email: david.laurie@bbsrc.ac.uk; Assigned to chromosome 1HL using wheat/barley addition lines.; PCR PRimers; FORWARD: M13 Forward; BACKWARD: M13 Reverse; Insert Length: 1135 Std Error: 0.00; Class: shotgun; High quality sequence stop: 1135.
Note: Vector: PUC18; Site_1: PstI; Site_2: PstI; Genomic fragments from PstI digest of DNA extracted from leaves.
DNA
catcccccgccacgaaatcagcaaggtgcgtgtgtgtgctccgtagcacc
ctctgttacttaattcaaccccaagtcattccttactttgatgtacgcct
tggaccttcttcttcctcctccactggccactgggtaccggcggtagaat
tgcaatcccagttgctcactccctttcaaccctgtggtcatggctatgca
cgcatggacagttccaagccaccaactgccatgcagtggccaagggagcc
cggtcgcccatcccaacatcttttttctttcgcccggtttcgtcagataa
ggtttatcttgaatgacggcccgccgggtcttgatatttctgttttatat
tccgattctcgccatcaagatgggcgcaagtggccggcatctgtggtcat
ccacgccacatgattgttaggtaggcccgtccgtccatgcggcggatgcg
acgatgtgtcggcgtcgccacacggaaggcggcttggagaaaaaggggaa
agggaaaggcagtcgaagaaatggaaagggcaaaggatgcttcgctgtca
accaagattattttttctgatttaacggcacttcaatgattgagctggcg
cataattgaagcgcatgattgcatccggtagccatgtactcctagctacc
tggtccatggatggcgcatacctgattgcatccgccatgtgtccatgtcc
actagctctctggtcatataattgtattgaccaataatactagtggactt
cttattctctcttctatttttctctccaaggaaaacactagtcagtactc
agtaggaatcataagaactcacctacctaatgtaggattgcctacttact
gaagctactctactttgtgatgtgtcacaggtcatctgctctctctgcaa
caaagaacaggatgtacgtgcctactgacaagcgttctacagtaattttc
accttttggctgtgctagtggcatgacatgaaaactgctcgtttggatca
acaggtgcagaagaactgctccggttgtggggcatgcatggggaaatact
tctgtgaaaaatgcaacttctttgacgatgatgtacgcgtgttcacattc
ctgagccaaggattagttactctgttaagcattct
BLAST
BLAST Search