Query (optional)   in Class  

GrainGenes Sequence Report: AZ254920

[ Printable Version ]  [ Submit comment/correction ]

Sequence
AZ254920
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum monococcum
Keyword
GSS
Species
Triticum monococcum
Cultivar
DV92
Clone Library
wheat BAC library
Tissue
leaf
Data Source
genbankRelease 135, Apr 15 2003
Title
F467 wheat BAC library Triticum monococcum genomic, DNA sequence.
Strain
lab_host Laboratory host
Remark
DB_xref: taxon:4568
Locus Comment: Contact: Feuillet, C.; B. Keller; University of Zurich,Institute of Plant biology; Zollikerstr. 107, CH-8008 Zurich, Switzerland; Tel: 4116348223; Fax: 4116348204; Email: feuillet@botinst.unizh.ch; Insert Length: 474 Std Error: 0.00; Class: shotgun.
Note: Vector: Name of vector.; Lijavetzky, D., Muzzi, G., Wicker, T., Keller, B., Wing, R., & Dubcovsky J. (1999) Genome 42, 1176-1182.
DNA
aggttgacaaggggagtcctttggataagatcacaggctcggacttgtcc
cgtggcggcgtggagcggccgccggagttgctgaactccgacgagcaatt
gctcgcagaggaggaggttcagagaggggttttcggatgggctagtgagt
ggctttgaggctcacgtctgggtaccttttataggagcaggggaggtcag
aatcgagcggtttcatagttgttattgacggcaataaaagcagcagtttc
ctctagctctaatggccattagggggtgcctcccttaaggcgcactacta
gagggaaggagtcgagagagcatggggaaccgattcaggaggtcagtggt
tgcgggaaaagggagaggaagcgttggagtgcagcctaagccatggatgt
ctctctgtacgtgaacatgcagatgtgcacgaggaggaagatgaacgctt
cgctagtgggctgctctgtcagtt
BLAST
BLAST Search