Query (optional)   in Class  

GrainGenes Sequence Report: CX662666

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CX662666
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC156186
NCBI UniGene
Hv.26075
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'CDNA clone: FLbaf28b03, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Bonus
Clone Library
Expressed sequences from Barley
Developmental Stage
Dark grown for 7 days after planting, then induced by 5 hours of light
Data Source
genbankRelease 145, Dec 15 2004
genbankUpdated Nov 2006
Title
EST 501 Expressed sequences from Barley Hordeum vulgare subsp. vulgare cDNA clone P501 5', mRNA sequence.
Strain
lab_host E.coli
vulgare
Clone
P501
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Hansson, M.; Dept. of Biochemistry; Lund University, Center for Chemistry; Box 124, SE-22100 Lund, Sweden; Tel: 46 46 2220105; Fax: 46 46 2224534; Email: mats.hansson@biokem.lu.se; Gadjieva, R., E. Axelsson, U. Olsson, J. Vallon-Christersson and M.; Hansson. Plant Physiol. Biochem. 42 (2004) 681-685; Seq primer: TAACAATTTCACACAGG.
Note: Organ: Leaf; Vector: pUC18; Site_1: SphI; Site_2: BamHI; Zakhrabekova, S., C.G. Kannangara, D. von Wettstein and M. Hansson. Plant Physiol. Biochem. 40 (2002) 189-197
DNA
gatccgctccaagtgggtaccctgcctcgagttcagcaaggttggcttcg
tcttccgtgagcacaacagctcccccggatattacgacggccgatactgg
acaatgtggaagctgcctatgtttgggtgcaccgacgccacacaggtgct
caatgaggtcgaggaggtcaaaaaggagtaccctgacgcctacgtccgca
tcatcggctttgacaacctgcggcaggtgcagtgcgtcagcttcatcgcc
ttcaggccaccgggttgcgaggagtccggcaaggcataaagtgcaagttg
aagtaaccgatatacatgccatgttagttcacattggtcggtcggtagct
ctgctttctcaattttacttcttgttccaatcatatgtgaatatacgagc
atatgtatgtaagcacctaccaacgtaggtcgaggaagatgcatatgaga
atcatagtaccggctatacatactttgtttgcagctggaaaanaaanaan
naaaaaaaanaaaaaannnnaancannggaanaaaaananaaaaactcga
gcatg
BLAST
BLAST Search