Query (optional)   in Class  

GrainGenes Sequence Report: CX662668

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CX662668
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC180662
NCBI UniGene
Hv.9069
DB Remark
Locus Source: Hordeum vulgare subsp. vulgare
UniGene title 'Transcribed locus, moderately similar to NP_565093.1 NDH-O (NAD(P)H:PLASTOQUINONE DEHYDROGENASE COMPLEX SUBUNIT O) [Arabidopsis thaliana]'
Keyword
EST
Species
Hordeum vulgare subsp. vulgare
Cultivar
Bonus
Clone Library
Expressed sequences from Barley
Developmental Stage
Dark grown for 7 days after planting, then induced by 5 hours of light
Data Source
genbankRelease 145, Dec 15 2004
genbankUpdated Nov 2006
Title
EST 503 Expressed sequences from Barley Hordeum vulgare subsp. vulgare cDNA clone P503 5', mRNA sequence.
Strain
lab_host E.coli
vulgare
Clone
P503
Remark
DB_xref: taxon:112509
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Hansson, M.; Dept. of Biochemistry; Lund University, Center for Chemistry; Box 124, SE-22100 Lund, Sweden; Tel: 46 46 2220105; Fax: 46 46 2224534; Email: mats.hansson@biokem.lu.se; Gadjieva, R., E. Axelsson, U. Olsson, J. Vallon-Christersson and M.; Hansson. Plant Physiol. Biochem. 42 (2004) 681-685; Seq primer: TAACAATTTCACACAGG.
Note: Organ: Leaf; Vector: pUC18; Site_1: SphI; Site_2: BamHI; Zakhrabekova, S., C.G. Kannangara, D. von Wettstein and M. Hansson. Plant Physiol. Biochem. 40 (2002) 189-197
DNA
gatcgctggatgagcggcttgcgagggaggataatgttctgtgcataaat
ctattcattatgtggtgacgctgtgacattgctccacggatgcaaaacga
aacagttgtggatggaagaaacaatagtgaaattgattcaaaaatgtttt
actaaaaaaaaaaaaaaactcgagcatg
BLAST
BLAST Search