Query (optional)   in Class  

GrainGenes Sequence Report: CX779711

[ Printable Version ]  [ Submit comment/correction ]

Sequence
CX779711
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
TIGR Gene Index
TC164808
NCBI UniGene
Hv.3862
DB Remark
Locus Source: Hordeum vulgare
UniGene title 'CDNA clone: FLbaf88d18, mRNA sequence'
Keyword
EST
Species
Hordeum vulgare
Cultivar
Ingrid BC mlo-5
Clone Library
HO
Tissue
leaf epidermis, 6 h and 24 h post inoculation with Blumeria graminis
Developmental Stage
7 d after germination
Data Source
genbankRelease 145, Dec 15 2004
genbankUpdated Nov 2006
Title
HO40A15S HO Hordeum vulgare cDNA clone HO40A15 5-PRIME, mRNA sequence.
Strain
lab_host XL10-Gold
Clone
HO40A15
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'mRNA';
Feature: source: mol_type = 'mRNA'
Locus Comment: Contact: Patrick Schweizer; Transcriptome Analysis, Cytogenetics Department; Institute of Plant Genetics and Crop Plant Research (IPK); Corrensstr. 3, D-06466 Gatersleben, Germany; Tel: 0049 (0)39482-5660; Fax: 0049 (0)39482-5595; Email: schweiz@ipk-gatersleben.de; Insert Length: 394 Std Error: 0.00; Plate: 40 row: A column: 15; Seq primer: SK.
Note: Vector: pBluescript SK+; Site_1: EcoRI (5'-end of cDNA); Site_2: XhoI (3'-end of cDNA); Approximately 5 % of the clones correspond to cDNA from the fungi B. graminis hordei and tritici, respectively. Due to a cloning artefact caused by the kit, in most cases the EcoRI site is NOT present, as well as the EcoRIadapter used for cloning. To excise the insert, restriction sites upstream EcoRI should be used (e.g. BamHI, SalI,PstI). NOTE: Also due to the cloning system used Blue/white selection for recombinats is not 100% reliable. Average insert size is 1.2 kb
DNA
aagtgtcacatgcagtggctcgaaaaccactgcaagaaggttgcagcttg
acgctacaccagttcatcgtcttaccaatcgagttgctttagatgttaat
aatccgacgacataaattaggcacgtatagcctcattttgccatcttttt
tttcctgtccaattaactggagcaagaggggctcctagacggtagaattt
tgtacccaagtcagtcaatctgtcaaacttggcatgaaagattaggacac
gatgcttggccttgatgtgttgctagacaacgtttttgtacttaatgttg
ctcgagtttcaacactgcaccggttatggcataataacctgacatttcta
ctgaggtgttcgtatttgtgagttatcatatgcaattacgtttg
BLAST
BLAST Search