Query (optional)   in Class  

GrainGenes Sequence Report: D00124

[ Printable Version ]  [ Submit comment/correction ]

Sequence
D00124
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
H3
histone
Species
Triticum aestivum
Cultivar
Horoshirikomugi
Tissue
seed
Data Source
genbankRelease 135, Apr 15 2003
Title
Triticum aestivum H3 gene, 5' flanking region.
Clone
pTH081
Remark
DB_xref: taxon:4565
Feature: mRNA: note = 'H3 mRNA (alt.)'
Feature: source: mol_type = 'genomic DNA';
Gene: H3
Locus Comment: There are pyrimidine-rich sequences just in the upstream region of; the TATA box of the wheat H3, H4, and maize histon genes. These; sequences are likely candidates for the cis-acting control elements; which regulate transcription of the higher plant histone genes; (discussed in [1]).
EMBL Feature
TATA_signal7076Location: 70..76
feature_gene104107Location: 104..107
DNA
cgcctccccttcccgaaacacagcgcgcccaaatttggccaggcccgccc
gcgcccactcctcttctccttaaaacactccccgaaccggctccattctc
catccac
BLAST
BLAST Search