Query (optional)   in Class  

GrainGenes Sequence Report: E01623

Sequence
E01623
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum vulgare
Keyword
JP 1988164888-A/1
Species
Hordeum vulgare
Data Source
genbankRelease 135, Apr 15 2003
Title
DNA fragment having promoter activity.
Remark
DB_xref: taxon:4513
Feature: source: mol_type = 'genomic DNA';
Locus Comment: OS Hordeum vulgare; PN JP 1988164888-A/1; PD 08-JUL-1988; PF 26-DEC-1986 JP 1986314698; PI HASHIMOTO HIROYUKI, NAKAMURA TAKU, TSUCHIDA SHINICHI, PI; KOYAMA FUMIHIRO; PC C12N15/00,C07H21/04,C12N1/20,(C12N1/20,C12R1:19); CC; strandedness: Single;; CC topology: Linear;; CC hypothetical: No;; CC anti-sense: No;; CC *source: tissue_type=Leaf.
DNA
ggatccaagtataactcacacggaggttacgcccccaaacaatttgttga
gtaatgcacacctaaagaaaaaggatcggaggttcgtgttagaagttcaa
agcgaactagaaattggcttgataaaaagcgtaggactaggaccagacaa
caagggaaagggaaaaagggaaaaagttcgaaggtatgttatacaaaaag
ttccaacactatgttactattcagtactatgttttatggatcc
BLAST
BLAST Search