Query (optional)   in Class  

GrainGenes Sequence Report: E02909

[ Printable Version ]  [ Submit comment/correction ]

Sequence
E02909
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
JP 1991127984-A/2
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
DNA encoding wheat dihydrodipicolinate synthetase (DHDPS).
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic RNA';
Locus Comment: OS Wheat; PN JP 1991127984-A/2; PD 31-MAY-1991; PF 12-OCT-1989 JP 1989265720; PI YAMADA YASUYUKI, HASHIMOTO TAKASHI, KANEKO TAKASHI PC; C12N9/00,C12N1/21,C12N15/52,(C12N1/21,C12R1:91); CC strandedness:; Double;; CC topology: Linear;; CC hypothetical: No;; CC anti-sense: No;; CC *source: clone=pDA17;; FH Key Location/Qualifiers; FH; FT 5'UTR 1..87; FT CDS 88..1254; FT /product='wheat dihydrodipicolinate FT; synthetase'; FT /note='DHDPS'; FT mat_peptide 88..1251; FT /product='wheat dihydrodipicolinate FT; synthetase'; FT 3'UTR 1255..1474.
DNA
ccaaaccaaagccctaaatccctctttcggaagataggagccgccccctt
tcgtcgtcgccgccatcgccgttctacagctgccgccatgccgtacctcc
agcccccgcgcccccacccccacccccacccgacctcccgcctctcgcgc
gcgtcgccgccgtcgccgttcccgttcttccccgccgggacatcgcgctc
cggtcgtctccaacccgtcccagtctccggccactcggcctcgagggtta
gtaaaggaaagtttgcagttgcagccgtcactctagatgattatcttccg
atgcgaagtactgaagtgaaaaaccggacatcaacagatggaatcaaaag
cctcagactaatcacagcggtcaaaaccccctatttgccagatggaagat
ttgatcttgaagcatacgattctctgataaacacgcaaataaatggcggt
gcggaaggtgtaatagttggaggaacaacaggagaaggtcacctcatgag
ctgggatgagcacatcatgctcatcgggcatactgttaactgctttggag
ccaacattaaagtgataggcaacacgggaagtaactcaaccagagaagct
gttcacgcgacagagcagggatttgctgttggcatgcatgcagctcttca
tgtcaatccttactacgggaagacctcaactgaaggcctgatctctcatt
ttaaggaagtcctcccgatgggcccaacaatcatttacaacgtgccatcc
aggacaagtcaggacatacctccaccagtcattgaggcgctttcatgtta
ctcaaacatggcaggagtgaaagaatgtgtcggacatgagcgggttaagt
gctacaccgacaaaggcatatcaatatggagcggcaacgatgatgaatgt
catgactcaaggtggaagtatggcgctactggagtcatttctgtggcgag
caaccttgttcccggtctcatgcatagcctcatgtttgaaggggagaatg
cggcgctaaatgagaagctactgcctctgatgaaatggctgttctgcgag
cctaacccgatcggtctcaacaccgccctggctcagctcggcgtggtgag
acctgttttcaggttgccgtacactccccttcctcttgagaagagggtgg
agtttgtccggattgtcgaagccattggacgtgagaactttgtgggacag
aaggagtcccgggttctggatgacgatgatttcgtgttgatcagcaggta
ttgaatatgtgtgtgagttctttgtgtccagtgtatgctgacgaacagcg
gtagtgtcacagtgttgtttgcggatcgtttagacgcttcgtttgttcac
cagtcatttgttgatctttttctctgactgcatgttaatttggaacccgt
ttggtttcttggcaccttgtgataccagttccagtaagatatgagaatag
cttgagacaaaaaaaaaaaaaaaa
BLAST
BLAST Search