Query (optional)   in Class  

GrainGenes Sequence Report: E02910

[ Printable Version ]  [ Submit comment/correction ]

Sequence
E02910
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Triticum aestivum (bread wheat)
Keyword
JP 1991127984-A/3
Species
Triticum aestivum
Data Source
genbankRelease 135, Apr 15 2003
Title
DNA encoding wheat dihydrodipicolinate synthetase (DHDPS).
Remark
DB_xref: taxon:4565
Feature: source: mol_type = 'genomic RNA';
Locus Comment: OS Wheat; PN JP 1991127984-A/3; PD 31-MAY-1991; PF 12-OCT-1989 JP 1989265720; PI YAMADA YASUYUKI, HASHIMOTO TAKASHI, KANEKO TAKASHI PC; C12N9/00,C12N1/21,C12N15/52,(C12N1/21,C12R1:91); CC strandedness:; Double;; CC topology: Linear;; CC hypothetical: No;; CC anti-sense: No;; CC *source: clone=pED0801;; FH Key Location/Qualifiers; FH; FT CDS 1..993; FT /product='wheat dihydrodipicolinate FT; synthetase'; FT /note='DHDPS'; FT mat_peptide 1..990; FT /product='wheat dihydrodipicolinate FT; synthetase'; FT 3'UTR 994..1187.
DNA
atggctgctgcggccatcactactgatgattatcttccaatgcgaagtac
tgaagtgaaaaatcggacatcagtagatggaatcaaaagtctcagactaa
tcacagcggtcaaaaccccctatttgccagatggaagatttgatcttgaa
gcatatgattctttgataaacacgcaaataaacgggggcgccgaaggtgt
aattgttggtggaacaacaggagaaggtcatcttatgagctgggatgaac
acatcatgctcatcgggcacactgttaactgctttggaactaacattaaa
gtgataggcaacacgggaagtaactcaactagagaagcgattcacgcttc
agagcagggatttgctcttggcatgcatgcagctctccatgtcaatcctt
actatgggaagacctcaactgcaggactgatctctcatttcgacgaagtc
ctcccgatgggtccaacaatcatttacaatgtgccatccaggactggtca
ggacatacctcctgcagtcattgaggcactctcaagttatccaaacatgg
caggagtgaaagaatgtgttggacatgaacgagtgaagtgctacacagac
aaaggtataacaatatggagtggcaatgatgacgaatgccatgattcaag
gtggaagtatggtgctactggagtcatttctgtgactagcaaccttgttc
ctggtctcatgcgcagtctcatgtttgaaggggagaatgcggccctaaat
gagaagctactgcctctgatgaaatggttattttctgagcctaatccgat
tggtctcaacactgccctggctcagctcggtgtagtgaggcctgttttca
ggagaccgtatgcccctctctctcttgaaaagaggaccgagtttgtccgg
attgttgaagcaatcgggcgggagaactttgtgggacagaaagaggtgcg
ggttctggatgatgatgattttgtgttgatcagtaggtattaaataagtg
agttcattgtgcgctatgtacgttacgaacagcggcggttctccttttag
acatttcatcagttgttcaacagccatatgttttatcttttctgtgattg
gaagttaacttggaaccctgtggggtttctttgcaccctataatgccagt
tctagtgagaaatgaggataaaaaaaaaaaaaaaaaa
BLAST
BLAST Search