Query (optional)   in Class  

GrainGenes Sequence Report: FB292236

[ Printable Version ]  [ Submit comment/correction ]

Sequence
FB292236
External Databases
Data at GenBank
Data at EMBL
Data at DDBJ
DB Remark
Locus Source: Hordeum murinum subsp. leporinum (Hordeum leporinum)
Species
Hordeum murinum subsp. leporinum
Data Source
genbankDownloaded 2008-2009
Title
Sequence 5 from Patent WO2006107954.
Strain
leporinum
Remark
DB_xref: taxon:98112
Feature: source: mol_type = 'unassigned DNA';
DNA
atggcaaataagcatttgtcacttagtttattcttggtcttattgggact
ttcagcatctctcgccagtgga
BLAST
BLAST Search